this post was submitted on 23 Jul 2023
451 points (100.0% liked)

Memes

45287 readers
2076 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago
MODERATORS
 

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments
[โ€“] capy_bara@lemmy.world 2 points 1 year ago (1 children)

There is also epigenetic modifications to be considered

[โ€“] Mininux@sh.itjust.works 1 points 1 year ago

Oh cool I didn't know that stuff, it's super interesting