An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"
this post was submitted on 23 Jul 2023
451 points (100.0% liked)
Memes
45280 readers
2076 users here now
Rules:
- Be civil and nice.
- Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.
founded 5 years ago
MODERATORS
you are viewing a single comment's thread
view the rest of the comments
view the rest of the comments
I wonder if theoretically you could share humans through the internet? Share your sequence and someone can download it and build it with a theoretical machine. Would probably be a few Petabytes of data though like you can see in that Black Mirror episode with that spaceship.
If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences
Wikipedia: Human genome#Information content
There is also epigenetic modifications to be considered
Oh cool I didn't know that stuff, it's super interesting